Top » Catalog » SNPs » Z5921

$18.00

Z5921
[Z5921]

Z5921
hg38 Position: ChrY:6949088..6949088
Ancestral: A
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: L1a2a1a
Comments: Downstream of M357 > Z5920
Forward Primer: Z5921_F CTACTTGAAGATTCTGCAAACCATC
Reverse Primer: Z5921_R GATTTTAGCAATGGAACCAATG
Reviews

Customers who bought this product also purchased
Y17954
Y17954
Y6253
Y6253
Y12419
Y12419
Y76629
Y76629
Y12889
Y12889
Z5920
Z5920
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies