Top » Catalog » SNPs » Z5921

$18.00

Z5921
[Z5921]

Z5921
hg38 Position: ChrY:6949088..6949088
Ancestral: A
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: L1a2a1a
Comments: Downstream of M357 > Z5920
Forward Primer: Z5921_F CTACTTGAAGATTCTGCAAACCATC
Reverse Primer: Z5921_R GATTTTAGCAATGGAACCAATG
Reviews

Customers who bought this product also purchased
Y76629
Y76629
Y12889
Y12889
Z5920
Z5920
FGC40735
FGC40735
L-M20 Panel
L-M20 Panel
M2667
M2667
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies