Top » Catalog » SNPs » Z29764

$18.00

Z29764
[Z29764]

Z29764
hg38 Position: ChrY:17257342..17257342
Ancestral: A
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not lised)
Comments: Equiv to PH1631
Forward Primer: Z29764v2_F GGGGACAATTGAGTGGCTATC
Reverse Primer: Z29764v2_R GAGGATTGCTTGAGCCCAC
Reviews

Customers who bought this product also purchased
Y36979
Y36979
L879
L879
M232
M232
L145
L145
L1345
L1345
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies