Top » Catalog » SNPs » Z29764

$18.00

Z29764
[Z29764]

Z29764
hg38 Position: ChrY:17257342..17257342
Ancestral: A
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not lised)
Comments: Equiv to PH1631
Forward Primer: Z29764v2_F GGGGACAATTGAGTGGCTATC
Reverse Primer: Z29764v2_R GAGGATTGCTTGAGCCCAC
Reviews

Customers who bought this product also purchased
Y83965
Y83965
U152
U152
L21
L21
Z2105
Z2105
Z2109
Z2109
Y101118
Y101118
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies