Top » Catalog » Y SNPs » A7298

$18.00

A7298
[A7298]

A7298
hg38 Position: ChrY:7553495..7553495
Ancestral: T
Derived: G
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF13 > MC14 > A2070
Forward Primer: A7298_F GACCCTTGGAAAATCTGGTTG
Reverse Primer: A7298_R ATGGCCAAGAAATTATCCTAAGC
Reviews

Customers who bought this product also purchased
A2070
A2070
A11683
A11683
U152
U152
L21
L21
M343
M343
BY246
BY246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies