Top » Catalog » SNPs » FGC36923

$18.00

FGC36923
[FGC36923]

FGC36923
hg38 Position: ChrY:8955635..8955635
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC36923_F GCTAGTGGAAATGCCATTCAG
Reverse Primer: FGC36923_R GAGGATGGCCACTGCTTC
Reviews

Customers who bought this product also purchased
FGC37130
FGC37130
Z11005
Z11005
A10231
A10231
FGC37037
FGC37037
FGC42304
FGC42304
FGC36924
FGC36924
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies