Top » Catalog » SNPs » FGC41768

$18.00

FGC41768
[FGC41768]

FGC41768
hg38 Position: ChrY:15297948..15297948
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC41768_F TCTCCTCCTTCTGACTTTCTTGAC
Reverse Primer: FGC41768_R AAAACAACTGTTCCCCTCACTG
Reviews

Customers who bought this product also purchased
Z11005
Z11005
FGC37037
FGC37037
A10231
A10231
FGC36924
FGC36924
FGC42304
FGC42304
FGC36923
FGC36923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies