Top » Catalog » SNPs » FGC42304

$18.00

FGC42304
[FGC42304]

FGC42304
hg38 Position: ChrY:7753428..7753428
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC42304_F GAAATTGATTGTAAAATATGTGGGTC
Reverse Primer: FGC42304_R GATTATCTCAGTCCTTATCTCAACCA
Reviews

Customers who bought this product also purchased
FGC41767
FGC41767
FGC37130
FGC37130
Z11005
Z11005
FGC37037
FGC37037
A10231
A10231
FGC36924
FGC36924
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies