Top » Catalog » SNPs » ZS8379

$18.00

ZS8379
[ZS8379]

ZS8379
hg38 Position: ChrY:6966744..6966744
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream J1-FGC1713. Also below R1b-DF105
Forward Primer: ZS8379_F GAAAGGGTTGAATGCTGAGG
Reverse Primer: ZS8379_R CTGAACACCCCGATCTCATC
Reviews

Customers who bought this product also purchased
L1335
L1335
BY108617
BY108617
DF13
DF13
FGC32795
FGC32795
L21
L21
A18726
A18726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies