Top » Catalog » SNPs » ZS8379

$17.50

ZS8379
[ZS8379]

ZS8379
HG19 Position: ChrY:6834785..6834785
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8379_F GAAAGGGTTGAATGCTGAGG
Reverse Primer: ZS8379_R CTGAACACCCCGATCTCATC
Reviews

Customers who bought this product also purchased
FGC4133
FGC4133
FGC46309
FGC46309
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
DF85
DF85
A738
A738
S588
S588
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
1 x mtComplete
1 x HVR1
$229.00
Haplogroup Info
Other products
Currencies