Top » Catalog » SNPs » ZS8379

$18.00

ZS8379
[ZS8379]

ZS8379
HG19 Position: ChrY:6834785..6834785
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8379_F GAAAGGGTTGAATGCTGAGG
Reverse Primer: ZS8379_R CTGAACACCCCGATCTCATC
Reviews

Customers who bought this product also purchased
A10642
A10642
Z39589
Z39589
A223
A223
A2501
A2501
DF49
DF49
FGC4133
FGC4133
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies