Top » Catalog » SNPs » ZS8379

$18.00

ZS8379
[ZS8379]

ZS8379
hg38 Position: ChrY:6966744..6966744
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream J1-FGC1713. Also below R1b-DF105
Forward Primer: ZS8379_F GAAAGGGTTGAATGCTGAGG
Reverse Primer: ZS8379_R CTGAACACCCCGATCTCATC
Reviews

Customers who bought this product also purchased
ZS7295
ZS7295
FGC1713
FGC1713
ZS7213
ZS7213
FGC1707
FGC1707
ZS8311
ZS8311
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies