Top » Catalog » SNPs » ZS8379

$18.00

ZS8379
[ZS8379]

ZS8379
HG19 Position: ChrY:6966744..6966744
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream J1-FGC1713. Also below R1b-DF105
Forward Primer: ZS8379_F GAAAGGGTTGAATGCTGAGG
Reverse Primer: ZS8379_R CTGAACACCCCGATCTCATC
Reviews

Customers who bought this product also purchased
S659
S659
M222
M222
Y24597
Y24597
A1206
A1206
A738
A738
S588
S588
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies