Top » Catalog » SNPs » ZS8379

$18.00

ZS8379
[ZS8379]

ZS8379
hg38 Position: ChrY:6966744..6966744
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream J1-FGC1713. Also below R1b-DF105
Forward Primer: ZS8379_F GAAAGGGTTGAATGCTGAGG
Reverse Primer: ZS8379_R CTGAACACCCCGATCTCATC
Reviews

Customers who bought this product also purchased
FT410057
FT410057
BY35731
BY35731
DF104
DF104
BY81963
BY81963
FT252196
FT252196
BY35726
BY35726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies