Top » Catalog » SNPs » A10242

$18.00

A10242
[A10242]

A10242
hg38 Position: ChrY:12425037..12425037
Ancestral: A
Derived: G
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10242_F CAATAGACAGAATCTTTCTCAACTTTACTAC
Reverse Primer: A10242_R GTTTAAACATCCCTGCAACTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies