Top » Catalog » SNPs » U290

$18.00

U290
[U290]

U290
hg38 Position: ChrY:19484172..19484172
Ancestral: T
Derived: A
Reference: Sims et al. 2007
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a
Comments: Below CTS1238/M3990
Forward Primer: U290_F CTCAGAGAATATGTCTGCAACAGC
Reverse Primer: U290_R CCAGCTGCTATGTTTTCCAG
Reviews

Customers who bought this product also purchased
CTS11248
CTS11248
CTS3119
CTS3119
M267
M267
Y65944
Y65944
V38
V38
M3907
M3907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies