Top » Catalog » SNPs » U290

$18.00

U290
[U290]

U290
hg38 Position: ChrY:19484172..19484172
Ancestral: T
Derived: A
Reference: Sims et al. 2007
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a
Comments: Below CTS1238/M3990
Forward Primer: U290_F CTCAGAGAATATGTCTGCAACAGC
Reverse Primer: U290_R CCAGCTGCTATGTTTTCCAG
Reviews

Customers who bought this product also purchased
V38
V38
M3907
M3907
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
CTS4361
CTS4361
L485
L485
M4232
M4232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies