Top » Catalog » SNPs » DF97

$18.00

DF97
[DF97]

DF97
hg38 Position: ChrY:20469793..20469793
Ancestral: G
Derived: A
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a1
Comments: approx. downstream of R-M222 R-DF85
Forward Primer: DF97_F CCCTTGTGGTTAGTCAGCCATC
Reverse Primer: DF97_R TGTAAGGTTGCTTCATTTCATGGG
Reviews

Customers who bought this product also purchased
FGC19852
FGC19852
A1147
A1147
FGC33214
FGC33214
FGC19842
FGC19842
FGC30115
FGC30115
A4697
A4697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies