Top » Catalog » SNPs » DF97

$18.00

DF97
[DF97]

DF97
hg38 Position: ChrY:20469793..20469793
Ancestral: G
Derived: A
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a1
Comments: approx. downstream of R-M222 R-DF85
Forward Primer: DF97_F CCCTTGTGGTTAGTCAGCCATC
Reverse Primer: DF97_R TGTAAGGTTGCTTCATTTCATGGG
Reviews

Customers who bought this product also purchased
A4697
A4697
FGC19845
FGC19845
BY21215
BY21215
A15499
A15499
FGC12184
FGC12184
A2204
A2204
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies