Top » Catalog » SNPs » FGC23141

$18.00

FGC23141
[FGC23141]

FGC23141
hg38 Position: ChrY:6983084..6983084
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC23141_F AGGAGGTGAGCTGCATGTG
Reverse Primer: FGC23141_R GAGATTTTGACCCCCAAGAG
Reviews

Customers who bought this product also purchased
FGC23134
FGC23134
A10284
A10284
A10283
A10283
A10282
A10282
FGC23143
FGC23143
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies