Top » Catalog » SNPs » YP4813

$18.00

YP4813
[YP4813]

YP4813
hg38 Position: ChrY:13261360..13261360
Ancestral: A
Derived: T
Reference: R1a-community (2015)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Below S7759 > YP1166 > Y20128.
Forward Primer: YP4813_F TCCTGGAATCAGGAGAGTCTG
Reverse Primer: YP4813_R GCCCCAGGGTTACTTATAGGAG
Reviews

Customers who bought this product also purchased
YP4693
YP4693
Z93
Z93
R1a-Z284 Panel
R1a-Z284 Panel
S6842
S6842
R1a Superclade Panel
R1a Superclade Panel
Y2395
Y2395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies