Top » Catalog » SNPs » YP4813

$18.00

YP4813
[YP4813]

YP4813
hg38 Position: ChrY:13261360..13261360
Ancestral: A
Derived: T
Reference: R1a-community (2015)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Below S7759 > YP1166 > Y20128.
Forward Primer: YP4813_F TCCTGGAATCAGGAGAGTCTG
Reverse Primer: YP4813_R GCCCCAGGGTTACTTATAGGAG
Reviews

Customers who bought this product also purchased
R1a-Z284 Panel
R1a-Z284 Panel
S6842
S6842
R1a Superclade Panel
R1a Superclade Panel
Y2395
Y2395
Z288
Z288
Z282
Z282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies