Top » Catalog » SNPs » U1

$18.00

U1
[U1]

U1
hg38 Position: ChrY:12946970..12946970
Ancestral: A
Derived: G
Reference: Sims et al 2009
ISOGG Haplogroup: G2a2b2a1a1a
Comments: Downstream of P303. upstream of L13. parallel to L42 and L139
Forward Primer: U1_F ACTGTGGGTCTCCTGGAGTG
Reverse Primer: U1_R CCTGCTTTTCAACTCAACAGG
Reviews

Customers who bought this product also purchased
L1263
L1263
S9751
S9751
BY45254
BY45254
Z30781
Z30781
Z29424
Z29424
M172
M172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies