Top » Catalog » SNPs » A30259

$18.00

A30259
[A30259]

A30259
hg38 Position: ChrY:21086682..21086682
Ancestral: A
Derived: T
Reference: Ed Leek (2021)
ISOGG Haplogroup: R1b
Comments: Below DF21 > FGC41930 > BY202124
Forward Primer: A30259_F CATGGTGGTGAGTGCCTATG
Reverse Primer: A30259_R CGGACCTGGCATCAAACTAC
Reviews

Customers who bought this product also purchased
CTS6498
CTS6498
FTB23403
FTB23403
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies