Top » Catalog » SNPs » CTS6498

$18.00

CTS6498
[CTS6498]

CTS6498
hg38 Position: ChrY:14829023..14829023
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below DF21 > FGC41930 > BY202124
Forward Primer: CTS6498_F TTACAGAAACGTCAGGAAGTGATC
Reverse Primer: CTS6498_R GCTATCTTGTCTCACAAACAAATCC
Reviews

Customers who bought this product also purchased
FTB23403
FTB23403
A30259
A30259
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies