Top » Catalog » SNPs » Z31418

$18.00

Z31418
[Z31418]

Z31418
hg38 Position: ChrY:8244919..8244919
Ancestral: T
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b1a1b3~
Comments: Subgrp under Z17887
Forward Primer: Z31418_F ATGTACCCTAGAACTTAAAGTATATTTTAGAAAATC
Reverse Primer: Z31418_R AGGGATTTCTGTTTTTCACATGAG
Reviews

Customers who bought this product also purchased
Z37375
Z37375
Z31423
Z31423
PH3797
PH3797
Z37370
Z37370
L645
L645
Z17887
Z17887
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S18605
$18.00
Haplogroup Info
Other products
Currencies