Top » Catalog » SNPs » Z31418

$18.00

Z31418
[Z31418]

Z31418
hg38 Position: ChrY:8244919..8244919
Ancestral: T
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b1a1b3~
Comments: Subgrp under Z17887
Forward Primer: Z31418_F ATGTACCCTAGAACTTAAAGTATATTTTAGAAAATC
Reverse Primer: Z31418_R AGGGATTTCTGTTTTTCACATGAG
Reviews

Customers who bought this product also purchased
Z17887
Z17887
PH3980
PH3980
G2-Z17887 Panel
G2-Z17887 Panel
Z39512
Z39512
Z37375
Z37375
Z31423
Z31423
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies