Top » Catalog » SNPs » FGC31708

$18.00

FGC31708
[FGC31708]

FGC31708
hg38 Position: ChrY:3295512..3295512
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1a1a2a
Comments: Below FGC31715.
Forward Primer: FGC31708_F TTACATTGCATTATTAGCTGATTTTGT
Reverse Primer: FGC31708_R TCTTGTCGAAATGTCTGTAGGC
Reviews

Customers who bought this product also purchased
Z3428
Z3428
FGC31715
FGC31715
G2a-L1259 Panel
G2a-L1259 Panel
CTS342
CTS342
FGC251
FGC251
mtUpgrade
mtUpgrade
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies