Top » Catalog » SNPs » FGC31708

$18.00

FGC31708
[FGC31708]

FGC31708
hg38 Position: ChrY:3295512..3295512
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1a1a2a
Comments: Below FGC31715.
Forward Primer: FGC31708_F TTACATTGCATTATTAGCTGATTTTGT
Reverse Primer: FGC31708_R TCTTGTCGAAATGTCTGTAGGC
Reviews

Customers who bought this product also purchased
Z27232
Z27232
L497
L497
Z26414
Z26414
L140
L140
Z6032
Z6032
U8
U8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies