Top » Catalog » SNPs » FGC31721

$18.00

FGC31721
[FGC31721]

FGC31721
hg38 Position: ChrY:19827287..19827287
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a (not listed)
Comments: .
Forward Primer: FGC31721_F CAAAATCTCACAGAAATAGCCAAC
Reverse Primer: FGC31721_R CCAGTGGTGAGATTGTTGGATAC
Reviews

Customers who bought this product also purchased
FGC31723
FGC31723
FGC31722
FGC31722
FGC31720
FGC31720
FGC31719
FGC31719
FGC31716
FGC31716
FGC31724
FGC31724
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies