Top » Catalog » SNPs » CTS342

$18.00

CTS342
[CTS342]

CTS342
hg38 Position: ChrY:6832130..6832130
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1c
Comments: Syn. with CTS11388; downstream PF3346
Forward Primer: CTS342_F TGTGCCTGAAAGTCCAATCTC
Reverse Primer: CTS342_R GCACCACAAAATACCTCAATGG
Reviews

Customers who bought this product also purchased
P38
P38
L1259
L1259
FGC21495
FGC21495
M9
M9
M253
M253
L1264
L1264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies