Top » Catalog » SNPs » CTS342

$18.00

CTS342
[CTS342]

CTS342
hg38 Position: ChrY:6832130..6832130
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1c
Comments: Syn. with CTS11388; downstream PF3346
Forward Primer: CTS342_F TGTGCCTGAAAGTCCAATCTC
Reverse Primer: CTS342_R GCACCACAAAATACCTCAATGG
Reviews

Customers who bought this product also purchased
M253
M253
L1264
L1264
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Z44144
Z44144
M201
M201
PH3992
PH3992
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies