Top » Catalog » SNPs » CTS342

$18.00

CTS342
[CTS342]

CTS342
hg38 Position: ChrY:6832130..6832130
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1c
Comments: Syn. with CTS11388; downstream PF3346
Forward Primer: CTS342_F TGTGCCTGAAAGTCCAATCTC
Reverse Primer: CTS342_R GCACCACAAAATACCTCAATGG
Reviews

Customers who bought this product also purchased
M172
M172
Z3196
Z3196
S9409
S9409
M96
M96
Z6552
Z6552
Y32607
Y32607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies