Top » Catalog » SNPs » Z17699

$18.00

Z17699
[Z17699]

Z17699
hg38 Position: ChrY:9578178..9578178
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: E1a1a
Comments: .
Forward Primer: Z17699_F TTTCAAGAAGATTTCATAGAAGGAATC
Reverse Primer: Z17699_R GTTGTGGATTAGATTGGAAACCA
Reviews

Customers who bought this product also purchased
M44
M44
E1a-M132 Panel
E1a-M132 Panel
Z31497
Z31497
Z5985
Z5985
CTS9548
CTS9548
A7710
A7710
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies