Top » Catalog » SNPs » A6549

$18.00

A6549
[A6549]

A6549
hg38 Position: ChrY:7852649..7852649
Ancestral: T
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2b (not listed)
Comments: Below Z138 > S6277 > Y15577
Forward Primer: A6549_F TGTAATGAATCCAAATCTGTGGTC
Reverse Primer: A6549_R CAAGTTTAGTATTCATGTGTATGGATTTC
Reviews

Customers who bought this product also purchased
BY1254
BY1254
Z140
Z140
A6397
A6397
Z2539
Z2539
S6270
S6270
Z58
Z58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies