Top » Catalog » SNPs » M5043

$18.00

M5043
[M5043]

M5043
hg38 Position: ChrY:19388594..19388594
Ancestral: C
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: M5043_F TTGGTCTGTTCAGGTTTTGG
Reverse Primer: M5043_R GAGAAAGCAAGCACCTTTGC
Reviews

Customers who bought this product also purchased
FT243964
FT243964
YSEQ-Alpha
YSEQ-Alpha
FT336337
FT336337
M267
M267
Y158793
Y158793
MZ289
MZ289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies