Top » Catalog » SNPs » M5043

$18.00

M5043
[M5043]

M5043
hg38 Position: ChrY:19388594..19388594
Ancestral: C
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: M5043_F TTGGTCTGTTCAGGTTTTGG
Reverse Primer: M5043_R GAGAAAGCAAGCACCTTTGC
Reviews

Customers who bought this product also purchased
MZ19
MZ19
PF2548
PF2548
FT76699
FT76699
FT31300
FT31300
BY9757
BY9757
BY9700
BY9700
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies