Top » Catalog » SNPs » M5043

$18.00

M5043
[M5043]

M5043
hg38 Position: ChrY:19388594..19388594
Ancestral: C
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: M5043_F TTGGTCTGTTCAGGTTTTGG
Reverse Primer: M5043_R GAGAAAGCAAGCACCTTTGC
Reviews

Customers who bought this product also purchased
BY8904
BY8904
A931
A931
BY10126
BY10126
Y141584
Y141584
MZ247
MZ247
Y183077
Y183077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies