Top » Catalog » SNPs » Z31200

$18.00

Z31200
[Z31200]

Z31200
hg38 Position: ChrY:12809107..12809107
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b2a1a1c2a1~
Comments: Observed in G2-L660 and J1
Forward Primer: Z31200_F CATGAGGCAGGATTTGTTTG
Reverse Primer: Z31200_R GCAGACTTCCAGCCTCTCAC
Reviews

Customers who bought this product also purchased
FGC12143
FGC12143
FGC12131
FGC12131
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies