Top » Catalog » SNPs » Z5009

$18.00

Z5009
[Z5009]

Z5009
hg38 Position: ChrY:14583866..14583866
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5009_F CTCAGCTAGGTTGCCTCCTC
Reverse Primer: Z5009_R GGCCATCTCTCTCTGGTGAC
Reviews

Customers who bought this product also purchased
M5343
M5343
BY74692
BY74692
CTS6185
CTS6185
BY198035
BY198035
M165
M165
PF2581
PF2581
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies