Top » Catalog » SNPs » Z5009

$18.00

Z5009
[Z5009]

Z5009
hg38 Position: ChrY:14583866..14583866
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5009_F CTCAGCTAGGTTGCCTCCTC
Reverse Primer: Z5009_R GGCCATCTCTCTCTGGTGAC
Reviews

Customers who bought this product also purchased
MZ117
MZ117
BY10290
BY10290
Z27803
Z27803
BY10314
BY10314
MZ236
MZ236
BY199425
BY199425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies