Top » Catalog » SNPs » Z5009

$18.00

Z5009
[Z5009]

Z5009
hg38 Position: ChrY:14583866..14583866
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5009_F CTCAGCTAGGTTGCCTCCTC
Reverse Primer: Z5009_R GGCCATCTCTCTCTGGTGAC
Reviews

Customers who bought this product also purchased
FT243964
FT243964
ALK777
ALK777
MZ278
MZ278
Y128375
Y128375
Y141584
Y141584
MZ289
MZ289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies