Top » Catalog » SNPs » Z5009

$18.00

Z5009
[Z5009]

Z5009
hg38 Position: ChrY:14583866..14583866
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5009_F CTCAGCTAGGTTGCCTCCTC
Reverse Primer: Z5009_R GGCCATCTCTCTCTGGTGAC
Reviews

Customers who bought this product also purchased
MZ260
MZ260
MZ182
MZ182
FT79706
FT79706
MZ129
MZ129
MZ161
MZ161
A24296
A24296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies