Top » Catalog » SNPs » CTS4122

$18.00

CTS4122
[CTS4122]

CTS4122
hg38 Position: ChrY:13296026..13296026
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a (not listed)
Comments: Below L161.1 > Y14338
Forward Primer: CTS4122_F GTAACAGCCCCTATGCAAGC
Reverse Primer: CTS4122_R CAGTACAAGAGCCATGGAACC
Reviews

Customers who bought this product also purchased
A814
A814
FGC8393
FGC8393
FGC7126
FGC7126
A2329
A2329
CTS10228
CTS10228
Y14605
Y14605
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies