Top » Catalog » SNPs » CTS4122

$18.00

CTS4122
[CTS4122]

CTS4122
hg38 Position: ChrY:13296026..13296026
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a (not listed)
Comments: Below L161.1 > Y14338
Forward Primer: CTS4122_F GTAACAGCCCCTATGCAAGC
Reverse Primer: CTS4122_R CAGTACAAGAGCCATGGAACC
Reviews

Customers who bought this product also purchased
Y45481
Y45481
I2a-M423 Panel
I2a-M423 Panel
S2742
S2742
A2293
A2293
A814
A814
FGC8393
FGC8393
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies