Top » Catalog » SNPs » Y5596

$18.00

Y5596
[Y5596]

Y5596
hg38 Position: ChrY:19858767..19858767
Ancestral: A
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: I2a1b2a1a (not listed)
Comments: Below S17250
Forward Primer: Y5596vl_F TTCTTCAATTGTCCTTATGCATTC
Reverse Primer: Y5596vl_R GGAAATTTCAAAAGGGAGGATG
Reviews

Customers who bought this product also purchased
A26390
A26390
Y152112
Y152112
Y51673
Y51673
PF4609
PF4609
Y57291
Y57291
FT138628
FT138628
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies