Top » Catalog » SNPs » A10527

$18.00

A10527
[A10527]

A10527
HG19 Position: ChrY:7309050..7309050
Ancestral: A
Derived: G
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10527_F CATTTATCCATCAGATAATCATAGGTG
Reverse Primer: A10527_R GGCTCTCATCTTATAAAATTCCCAG
Reviews

Customers who bought this product also purchased
DF85
DF85
ZS8379
ZS8379
S588
S588
FGC23742
FGC23742
A10642
A10642
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies