Top » Catalog » SNPs » A10528

$18.00

A10528
[A10528]

A10528
hg38 Position: ChrY:8221698..8221698
Ancestral: A
Derived: C
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10528v2_F CCACTGCTTGTCCCTACAGTC
Reverse Primer: A10528v2_R GTATTTTTTGTTTGTTTTGGGTGAC
Reviews

Customers who bought this product also purchased
A224
A224
S659
S659
A822
A822
S588
S588
A738
A738
A1775
A1775
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies