Top » Catalog » SNPs » A10528

$18.00

A10528
[A10528]

A10528
hg38 Position: ChrY:8221698..8221698
Ancestral: A
Derived: C
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10528v2_F CCACTGCTTGTCCCTACAGTC
Reverse Primer: A10528v2_R GTATTTTTTGTTTGTTTTGGGTGAC
Reviews

Customers who bought this product also purchased
A1775
A1775
DF85
DF85
ZS8379
ZS8379
FGC33468
FGC33468
M222
M222
A223
A223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies