Top » Catalog » SNPs » A10528

$18.00

A10528
[A10528]

A10528
hg38 Position: ChrY:8221698..8221698
Ancestral: A
Derived: C
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10528v2_F CCACTGCTTGTCCCTACAGTC
Reverse Primer: A10528v2_R GTATTTTTTGTTTGTTTTGGGTGAC
Reviews

Customers who bought this product also purchased
M222
M222
A223
A223
A984
A984
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
A224
A224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies