Top » Catalog » SNPs » S556

$18.00

S556
[S556]

S556
hg38 Position: ChrY:6807303..6807303
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: .
Forward Primer: S556_F AGTAATTTGCCTGCCTCAGC
Reverse Primer: S556_R GGAATCCTTCCAATATCTCATGG
Reviews

Customers who bought this product also purchased
FGC452
FGC452
S557
S557
S567
S567
S563
S563
FGC450
FGC450
S555
S555
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies