Top » Catalog » SNPs » A10535

$18.00

A10535
[A10535]

A10535
hg38 Position: ChrY:15079816..15079816
Ancestral: A
Derived: G
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10535_F CCAGCCTGGCTTGAAAAAC
Reverse Primer: A10535_R GAGGAGGGGTCTTGTTCTGTC
Reviews

Customers who bought this product also purchased
DF49
DF49
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
S659
S659
Z39589
Z39589
FGC64966
FGC64966
S603
S603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies