Top » Catalog » SNPs » A10535

$18.00

A10535
[A10535]

A10535
hg38 Position: ChrY:15079816..15079816
Ancestral: A
Derived: G
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10535_F CCAGCCTGGCTTGAAAAAC
Reverse Primer: A10535_R GAGGAGGGGTCTTGTTCTGTC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies