Top » Catalog » SNPs » S557

$18.00

S557
[S557]

S557
hg38 Position: ChrY:20987347..20987347
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: .
Forward Primer: S557_F TTTTATTGGCAAAGCCCAAG
Reverse Primer: S557_R CTTATCCCCTGGCTGAACAC
Reviews

Customers who bought this product also purchased
S559
S559
S565
S565
FGC454
FGC454
S558
S558
S564
S564
FGC452
FGC452
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies